View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17371_low_14 (Length: 208)

Name: NF17371_low_14
Description: NF17371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17371_low_14
NF17371_low_14
[»] chr7 (1 HSPs)
chr7 (81-184)||(23148665-23148772)


Alignment Details
Target: chr7 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 81 - 184
Target Start/End: Complemental strand, 23148772 - 23148665
Alignment:
Q  81 gctaatttaactaaaaaattgttactttcacttccaagtggctctttatttgtattact----caattacatgtagttatcatggtagcatgcatgcata 176  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||    
T  23148772 gctaatttaactcaaaaattgttactttcacttccaagtggctctttatttgtattactcaatcaattacatgtagttatcatggtagcatgcatgcata 23148673  T
Q  177 atgaagac 184  Q
    ||||||||    
T  23148672 atgaagac 23148665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University