View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17366_low_4 (Length: 342)

Name: NF17366_low_4
Description: NF17366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17366_low_4
NF17366_low_4
[»] chr4 (2 HSPs)
chr4 (37-229)||(35507987-35508179)
chr4 (296-342)||(35507874-35507920)


Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 37 - 229
Target Start/End: Complemental strand, 35508179 - 35507987
Alignment:
Q  37 atggggggttcggtgcgagacgtgaagtcaaagtcggagttggatgaggttgttcgcggcggttctccggcggtgcttcacttctgggcgtcatggtgtg 136  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  35508179 atgggtggttcggtgcgagacgtgaagtcaaagtcggagttggatgaggtggttcgcggcggttctccggcggtgcttcacttctgggcgtcatggtgtg 35508080  T
Q  137 aagcttccaaacacatggaccaactcttctctcatttggccattgatttccctcatacccatttcttaagggttcggttttctttcccaatta 229  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35508079 aagcttccaaacacatggaccaactcttctctcatttggccattgatttccctcatacccatttcttaagggttcggttttctttcccaatta 35507987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 296 - 342
Target Start/End: Complemental strand, 35507920 - 35507874
Alignment:
Q  296 ggttgaagctgaagaacaaccagagatatctgaggcttattctgtct 342  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  35507920 ggttgaagctgaagaacaaccagagatatctgaggcttattctgtct 35507874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University