View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17359_low_8 (Length: 298)

Name: NF17359_low_8
Description: NF17359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17359_low_8
NF17359_low_8
[»] chr2 (2 HSPs)
chr2 (1-108)||(9440551-9440658)
chr2 (1-92)||(9451792-9451884)


Alignment Details
Target: chr2 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 9440658 - 9440551
Alignment:
Q  1 ccatttaacaagaaaaaggatgatgacaaagggaaggaggaagtgaaacacataaattgattgttatgtcttttgttcaagacacaacttgtgtttggat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||    
T  9440658 ccatttaacaagaaaaaggatgatgacaaagggaaggaggaagtgaaacacatagcttgattgttatgtcttttgttcaagacacaacttgtgtttggat 9440559  T
Q  101 tagctgta 108  Q
    ||||||||    
T  9440558 tagctgta 9440551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 9451884 - 9451792
Alignment:
Q  1 ccatttaacaagaaaaaggatgatgacaaagggaaggaggaagtgaaacacataaattgattgttatgtc-ttttgttcaagacacaacttgt 92  Q
    ||||||||||||||||||||||| ||||||||||||||| ||||| || | ||   |||| ||||||||| |||||||||| ||| |||||||    
T  9451884 ccatttaacaagaaaaaggatgacgacaaagggaaggagaaagtgcaagagatggcttgactgttatgtcattttgttcaacacaaaacttgt 9451792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University