View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17355_low_12 (Length: 271)

Name: NF17355_low_12
Description: NF17355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17355_low_12
NF17355_low_12
[»] chr5 (2 HSPs)
chr5 (11-100)||(40869041-40869130)
chr5 (165-253)||(40868888-40868976)


Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 11 - 100
Target Start/End: Complemental strand, 40869130 - 40869041
Alignment:
Q  11 agaatatgtccatgcaatggaggctatcaagtgggggactgactatttcatcaaggctcacacacaaccaaatgttctatgggtagaggt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40869130 agaatatgtccatgcaatggaggctatcaagtgggggactgactatttcatcaaggctcacacacaaccaaatgttctatgggtagaggt 40869041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 165 - 253
Target Start/End: Complemental strand, 40868976 - 40868888
Alignment:
Q  165 aatccacgagccgtggttgcaattgagataaataatccctctaagctagttggaaaaatagtactccacgaggtattcaaatgtcgaaa 253  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||    
T  40868976 aatccacgagccgtggttgcaattgagataaataatccctctaagctagtcggaaaaatagtactacacgaggtattcaaatgtcgaaa 40868888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University