View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17352_low_7 (Length: 224)

Name: NF17352_low_7
Description: NF17352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17352_low_7
NF17352_low_7
[»] chr7 (1 HSPs)
chr7 (1-224)||(38196539-38196762)


Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 38196762 - 38196539
Alignment:
Q  1 gcaaaagataattcattcatctctagcagtcatgtagctggaacagaacactttagagtggctgatttgatggaacagaacaggcaaggatggaattggg 100  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38196762 gcaaaagataattcattcatctctagcagtcgtgtagctggaacagaacactttagagtggctgatttgatggaacagaacaggcaaggatggaattggg 38196663  T
Q  101 gattgatagatggtatgttcaatgaaagagacaaaggggagatttgcaagctcacaatcacaatggctacagaggaagacaagcttatttggaaatttaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38196662 gattgatagatggtatgttcaatgaaagagacaaaggggagatttgcaagctcacaatcacaatggctacagaggaagacaagcttatttggaaatttaa 38196563  T
Q  201 taatagaggtaattatactgtgaa 224  Q
    ||||||||||||||||||||||||    
T  38196562 taatagaggtaattatactgtgaa 38196539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University