View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17351_high_14 (Length: 334)

Name: NF17351_high_14
Description: NF17351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17351_high_14
NF17351_high_14
[»] chr1 (1 HSPs)
chr1 (93-317)||(28927246-28927469)


Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 93 - 317
Target Start/End: Original strand, 28927246 - 28927469
Alignment:
Q  93 taatctaagatgttaacctccgttgatggtgagtttttgaaacaaaaagtcaattggtccatcagttagatgtgaagatggtttcaatgctgcattaaat 192  Q
    |||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28927246 taatctaagatgttaacctctgttgatggtgaatttt-gaaacaaaaagtcaattggtccatcagttagatgtgaagatggtttcaatgctgcattaaat 28927344  T
Q  193 gcttctcgaaactttgcatcttctttccatgacttggtagttgcttgctataacttggcatctctcagtatctcggattttgaaatgaaagatgaattaa 292  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28927345 gcttctcaaaactttgcatcttctttccatgacttggtagttgcttgctctaacttggcatctctcagtatctcggattttgaaatgaaagatgaattaa 28927444  T
Q  293 tttttacatctagtgacttcaattt 317  Q
    |||||||||||||||||||||||||    
T  28927445 tttttacatctagtgacttcaattt 28927469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University