View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1734_low_82 (Length: 220)

Name: NF1734_low_82
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1734_low_82
NF1734_low_82
[»] chr3 (2 HSPs)
chr3 (42-219)||(51938179-51938356)
chr3 (1-33)||(51938375-51938407)


Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 42 - 219
Target Start/End: Complemental strand, 51938356 - 51938179
Alignment:
Q  42 aatgatcgttgcaattgcattgtatttttgtcaactcttagcaaaactcaatggcagacaaggagacaacaaaagagaagaatggatcagatttcagaaa 141  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51938356 aatgatcgttgcaattgcattgtatttttgtcaactcttagcaaaactcaatggcagacaaggagacaacaaaagagaagaatggatcagatttcagaaa 51938257  T
Q  142 tggaacaactattgacaacgttgttgggcgtcgtgggctacccatgatccaaacccacaagaaagttatggattcttc 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51938256 tggaacaactattgacaacgttgttgggcgtcgtgggctacccatgatccaaacccacaagaaagttatggattcttc 51938179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 51938407 - 51938375
Alignment:
Q  1 gtaaacatgaagctaacgtgtactacaactcat 33  Q
    ||||||||||||||||||||||| |||||||||    
T  51938407 gtaaacatgaagctaacgtgtaccacaactcat 51938375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University