View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1734_low_72 (Length: 236)

Name: NF1734_low_72
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1734_low_72
NF1734_low_72
[»] chr4 (2 HSPs)
chr4 (110-208)||(34005564-34005680)
chr4 (10-55)||(34005304-34005349)


Alignment Details
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 110 - 208
Target Start/End: Original strand, 34005564 - 34005680
Alignment:
Q  110 atcataactttacgaatgctttatatatctaaagcaatggatgcaaattg------------------atcattgataaaggatagcacactcattgaat 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||                  ||||||||||||||||||||||||||||||||    
T  34005564 atcataactttacgaatgctttatatatctaaagcaatggatgcaaattgatgaattggaggcacaaaatcattgataaaggatagcacactcattgaat 34005663  T
Q  192 caaaatagcaattaaaa 208  Q
    |||||||||||||||||    
T  34005664 caaaatagcaattaaaa 34005680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 10 - 55
Target Start/End: Original strand, 34005304 - 34005349
Alignment:
Q  10 cagaagaaaaagctaaggcctaagaaataaaactctgctatactat 55  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||    
T  34005304 cagaagaaaaagctaaggcctaagaaataaaactcagctatactat 34005349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University