View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1734_low_69 (Length: 237)

Name: NF1734_low_69
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1734_low_69
NF1734_low_69
[»] chr6 (1 HSPs)
chr6 (17-217)||(10680027-10680227)


Alignment Details
Target: chr6 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 17 - 217
Target Start/End: Original strand, 10680027 - 10680227
Alignment:
Q  17 cataggaaaaagtttgctgttggatggaatagaatttttgtcaattgnnnnnnnngtagaggcctaatgagtatggtgaggaatcatactatatataaat 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||    
T  10680027 cataggaaaaagtttgctgttggatggaatagaatttttgtcaattgaaaaaaaagtagaggcctaatgagtatggtgaggaatcatactatatataaat 10680126  T
Q  117 tgcttaatactaaacatgattactaaacatgtacatgatgcaagacacgacattcattattcaatgcaagactcaagctacagctgctctgtcgatgcac 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||    
T  10680127 tgcttaatactaaacatgattactaaacatgtacatgatgcaagacacgacattcattattcaatgcaagactcgagctacagctactctgtcgatgcac 10680226  T
Q  217 g 217  Q
    |    
T  10680227 g 10680227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University