View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1734_high_83 (Length: 210)

Name: NF1734_high_83
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1734_high_83
NF1734_high_83
[»] chr3 (1 HSPs)
chr3 (1-197)||(53969930-53970126)


Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 53969930 - 53970126
Alignment:
Q  1 taagattatacgtcgaattaagctgtggaggtgttatgactgcgtggtaggaatgcagctaccaactagagcttcaatctcctaaactccaaaacaccag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  53969930 taagattatacgtcgaattaagctgtggaggtgttatgactgcgtggtaggaatgcagctaccaattagagcttcaatctcctaaactccaaaacaccag 53970029  T
Q  101 agggaggggttttatgtgtgcaagaggtaatggttttagctataggtgatgagatatatgataagctataatgcccggaagaaatgttgttggtttc 197  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53970030 agggaggggttttatgtgtgcaaggggtaatggttttagctataggtgatgagatatatgataagctataatgcccggaagaaatgttgttggtttc 53970126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University