View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17349_low_7 (Length: 272)

Name: NF17349_low_7
Description: NF17349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17349_low_7
NF17349_low_7
[»] chr8 (1 HSPs)
chr8 (22-261)||(31455215-31455454)


Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 22 - 261
Target Start/End: Original strand, 31455215 - 31455454
Alignment:
Q  22 acgtagaagacgaggaaattcaacttcaagcattgaaagcagcatatatgagtatgattgctttagaaagaaggcaaagaaggaaatttctaagcaactt 121  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  31455215 acgtagaagacgaggaaattcaacttcaagcattgaaagcagcatatatgagtatgattgctttagaaagaaggcaaagaaggaaatttcaaagcaactt 31455314  T
Q  122 agtgaaatgaagaaaatggaaaacaaagtaaagcttttttctattatgggacaagatcaaaatttaatatttttggctaaggttttaagagaagctacca 221  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  31455315 ggtgaaatgaagaaaatggaaaacaaagtaaagcttttttctattatgggccaagatcaaaatttaatatttttggctaaggttttaagagaagctacca 31455414  T
Q  222 ccatcacaatatctatatttcgttctcttttactattcat 261  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  31455415 ccatcacaatatctatatttcgttctcttttactattcat 31455454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University