View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17346_low_6 (Length: 217)

Name: NF17346_low_6
Description: NF17346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17346_low_6
NF17346_low_6
[»] chr6 (1 HSPs)
chr6 (11-196)||(23928465-23928650)


Alignment Details
Target: chr6 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 11 - 196
Target Start/End: Original strand, 23928465 - 23928650
Alignment:
Q  11 gaataatatgacggagcaaaaaagcacatgcaaatcactcaatggtgcgcgcacaacagcttcctgtacagaaacgttggagcaacaagcgacacgttga 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23928465 gaataatatgacggagcaaaaaagcacatgcaaatcactcaatggtgcgcgcacaacagcttcctgtacagaaacgttggagcaacaagcgacacgttga 23928564  T
Q  111 aaaccaacaacgggacgactcaaatgcaatatagacacgtccttcttcaccacttggaattgtgtggggttttcgatatgtattcg 196  Q
    |||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23928565 aaaccagcaacgggacaactcaaatgcaatatagacacgtccttcttcaccacttggaattgtgtggggttttcgatatgtattcg 23928650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University