View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17345_high_9 (Length: 237)

Name: NF17345_high_9
Description: NF17345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17345_high_9
NF17345_high_9
[»] chr4 (2 HSPs)
chr4 (143-231)||(51294866-51294954)
chr4 (27-64)||(51294747-51294784)


Alignment Details
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 143 - 231
Target Start/End: Original strand, 51294866 - 51294954
Alignment:
Q  143 ccaatattttattatgtaacaactccgtcttgttttattttggttagcnnnnnnnatgttaaggaaatatttagggtttaggttattta 231  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||    
T  51294866 ccaatattttattatgtaacaactccgtcttgttttattttggttagctttttttatgttaaggaaatatttagggtttaggttattta 51294954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 64
Target Start/End: Original strand, 51294747 - 51294784
Alignment:
Q  27 tactaatatgattacaatgacattgaatatcaaaataa 64  Q
    ||||||||||||||||||||||||||||||||||||||    
T  51294747 tactaatatgattacaatgacattgaatatcaaaataa 51294784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University