View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17342_high_7 (Length: 317)

Name: NF17342_high_7
Description: NF17342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17342_high_7
NF17342_high_7
[»] chr8 (1 HSPs)
chr8 (40-307)||(6512456-6512722)


Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 40 - 307
Target Start/End: Complemental strand, 6512722 - 6512456
Alignment:
Q  40 gttgatgtgggaaggatgaatgggagataaggagaagaatacctactggaattgaggggtttagtacgaacatgaatgagaatgcaattagagttcttct 139  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||    
T  6512722 gttgatgtgagaaggatgaatgggagataaggagaagaatacctactggaattgagaggtttggtacgaacatgaatgagaatgcaattggagttcttct 6512623  T
Q  140 ttagaaggtggtccaccgcccatttcaccgcgcactggctattccgaccggtgttgatggcaatgacggtggttttggcggcggtggcagctcctaattc 239  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6512622 ttagaaggtggtccaccgcccatttcaccgcgcactggctattccgaccggtgttgatggcaatgacggtggttttggcggcggtggcagctcctaattc 6512523  T
Q  240 attagtaatcatttgcatgaagaattaaggttagttacttttttagaaaaaataagctcttgtctctg 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  6512522 attagtaatcatttgcatgaagaattaaggttagttacttttttaga-aaaataagctcttgtctctg 6512456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University