View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17334_low_2 (Length: 222)

Name: NF17334_low_2
Description: NF17334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17334_low_2
NF17334_low_2
[»] chr7 (2 HSPs)
chr7 (19-115)||(10894123-10894219)
chr7 (146-205)||(10894242-10894301)


Alignment Details
Target: chr7 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 19 - 115
Target Start/End: Original strand, 10894123 - 10894219
Alignment:
Q  19 aactaaacatgaacctagacatattttttcttcattttaattatgaagagattgataattgttataatgagaataaattgaggaaatgtgaatgaac 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10894123 aactaaacatgaacctagacatattttttcttcattttaattatgaagagattgataattgttataatgagaataaattgaggaaatgtgaatgaac 10894219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 146 - 205
Target Start/End: Original strand, 10894242 - 10894301
Alignment:
Q  146 ttacttggattatcatcttttgcagaagaggccatctctgactcagcttccgtccagtat 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10894242 ttacttggattatcatcttttgcagaagaggccatctctgactcagcttccgtccagtat 10894301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University