View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17330_high_24 (Length: 248)

Name: NF17330_high_24
Description: NF17330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17330_high_24
NF17330_high_24
[»] chr8 (1 HSPs)
chr8 (20-231)||(41785410-41785621)
[»] chr6 (1 HSPs)
chr6 (20-185)||(10834629-10834795)
[»] chr5 (1 HSPs)
chr5 (52-178)||(2281450-2281576)


Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 20 - 231
Target Start/End: Original strand, 41785410 - 41785621
Alignment:
Q  20 gaaaatggaagaattggcagaaaagttgaggaagaaaatggaagacaatatccgcttgttgcaccagaggatccacgtagcagaacaattgaacaatgag 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41785410 gaaaatggaagaattggcagaaaagttgaggaagaaaatggaagacaatatccgcttgttgcaccagaggatccacgtagcagaacaattgaacaatgag 41785509  T
Q  120 aacaaaagcagttgcaaattaacaaagataaggtacgaggaagagaacaagattcttggggagaaagtttctatttatgaagaggaactaagaaggctta 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41785510 aacaaaagcagttgcaaattaacaaagataaggtacgaggaagagaacaagattcttggggagaaagtttctatttatgaagaggaactaagaaggctta 41785609  T
Q  220 aagagggtgctg 231  Q
    ||||||||||||    
T  41785610 aagagggtgctg 41785621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 20 - 185
Target Start/End: Original strand, 10834629 - 10834795
Alignment:
Q  20 gaaaatggaagaattggcagaaaagttgaggaagaaaatggaagacaatatccg-cttgttgcaccagaggatccacgtagcagaacaattgaacaatga 118  Q
    |||||||||||||||||||| | | || ||  ||| ||||||| |||||||  | |||||||||| ||||||||||  | ||||||||  ||||||||||    
T  10834629 gaaaatggaagaattggcaggagattttagatagagaatggaaaacaatatagggcttgttgcactagaggatccatttggcagaacagctgaacaatga 10834728  T
Q  119 gaacaaaagcagttgcaaattaacaaagataaggtacgaggaagagaacaagattcttggggagaaa 185  Q
     ||||||| ||||||||||||||||||| ||||||| ||| |||||||||||||||| || ||||||    
T  10834729 aaacaaaaacagttgcaaattaacaaagttaaggtatgagcaagagaacaagattctgggagagaaa 10834795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 52 - 178
Target Start/End: Complemental strand, 2281576 - 2281450
Alignment:
Q  52 agaaaatggaagacaatatccgcttgttgcaccagaggatccacgtagcagaacaattgaacaatgagaacaaaagcagttgcaaattaacaaagataag 151  Q
    ||||||||||||| ||||| |   | ||||| | |||||||||||||||||||||| |||| || || ||||||  ||||| |||||| ||||||  ||     
T  2281576 agaaaatggaagataatatacatatattgcatcggaggatccacgtagcagaacaactgaataacgaaaacaaacacagttacaaattgacaaagcaaaa 2281477  T
Q  152 gtacgaggaagagaacaagattcttgg 178  Q
    ||| |||||||||||||| || |||||    
T  2281476 gtatgaggaagagaacaaaatgcttgg 2281450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University