View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1733-Insertion-8 (Length: 403)

Name: NF1733-Insertion-8
Description: NF1733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1733-Insertion-8
NF1733-Insertion-8
[»] chr7 (1 HSPs)
chr7 (260-401)||(3336114-3336251)
[»] chr2 (2 HSPs)
chr2 (310-403)||(12370058-12370151)
chr2 (7-91)||(12369809-12369892)


Alignment Details
Target: chr7 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 260 - 401
Target Start/End: Original strand, 3336114 - 3336251
Alignment:
Q  260 ataggactaggagtagggttagggtttgttaaaaagcagagnnnnnnnnntgtgataacactgcttgaattggggaggaagcaagcaaacgcctttgaca 359  Q
    |||||||||||||||| ||||||||||||||||| | ||||         |||||||||||||||||||||||||||||||||||||||||  |||||||    
T  3336114 ataggactaggagtagagttagggtttgttaaaa-gtagagaaaaaa---tgtgataacactgcttgaattggggaggaagcaagcaaacgtgtttgaca 3336209  T
Q  360 ggatttggctgtgcagcttgcatttgcattgggacaattttg 401  Q
    |||||||||||||||||||||||||| |||||||||||||||    
T  3336210 ggatttggctgtgcagcttgcatttggattgggacaattttg 3336251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 78; Significance: 3e-36; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 310 - 403
Target Start/End: Original strand, 12370058 - 12370151
Alignment:
Q  310 tgtgataacactgcttgaattggggaggaagcaagcaaacgcctttgacaggatttggctgtgcagcttgcatttgcattgggacaattttgga 403  Q
    |||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| ||||||||||||| |||||||||||||||||    
T  12370058 tgtgataacactgcttgaattggggaggaagcaagcaaacacgtttgacaggatttggctgtacagcttgcatttggattgggacaattttgga 12370151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 7 - 91
Target Start/End: Original strand, 12369809 - 12369892
Alignment:
Q  7 aatacggcaatggaaaatggtagggattgggatccaaataattcaacagtagcaatgaaacatatatatgtaactacggctgtaa 91  Q
    |||||||||| ||||||||||||||||||| ||||||||||||||||| |||| |||||||||||||||| ||||||||||||||    
T  12369809 aatacggcaagggaaaatggtagggattgg-atccaaataattcaacaatagcgatgaaacatatatatggaactacggctgtaa 12369892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University