View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17328_low_4 (Length: 210)

Name: NF17328_low_4
Description: NF17328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17328_low_4
NF17328_low_4
[»] chr2 (1 HSPs)
chr2 (1-202)||(21731606-21731807)


Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 21731807 - 21731606
Alignment:
Q  1 aatcttctcttttactgaaaaccctgattcagttctctataatgcattacttagaaacttgtttatgtttggtgaatatgaaaaaaccannnnnnngtat 100  Q
    ||||||||||||||||||||||||||||||| || |||| |||||||| |||||||| ||||||||||||||||||||||||||||||        ||||    
T  21731807 aatcttctcttttactgaaaaccctgattcaattatctacaatgcattccttagaaatttgtttatgtttggtgaatatgaaaaaaccctttttttgtat 21731708  T
Q  101 aaagaaatggttgagaaatctatgtgcccagatgaagattgttgcttatctgttttgaaatctttgttttatgtgtttcatgaaaaagggttgttgatga 200  Q
    |||||||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | ||||    
T  21731707 aaagaaatggttcagaaatctatgtgccctgatgaagattgttgcttttctgttttgaaatctttgttttatgtgtttcatgaaaaagggttgataatga 21731608  T
Q  201 tg 202  Q
    ||    
T  21731607 tg 21731606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University