View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17326_low_55 (Length: 241)

Name: NF17326_low_55
Description: NF17326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17326_low_55
NF17326_low_55
[»] chr2 (1 HSPs)
chr2 (1-82)||(40464099-40464180)


Alignment Details
Target: chr2 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 40464180 - 40464099
Alignment:
Q  1 atataagagatactaataaatattattggtcatatatgtgttggtaaattttgatggtctattatagactaaaaatataacc 82  Q
    ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  40464180 atataagagatactagtaaatattattggtcatatatgttttggtaaattttgatggtctattatagactaaaaatataacc 40464099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University