View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17326_high_45 (Length: 247)

Name: NF17326_high_45
Description: NF17326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17326_high_45
NF17326_high_45
[»] chr2 (2 HSPs)
chr2 (15-180)||(21716884-21717049)
chr2 (27-136)||(20656645-20656754)
[»] scaffold0903 (1 HSPs)
scaffold0903 (18-180)||(467-629)


Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 15 - 180
Target Start/End: Complemental strand, 21717049 - 21716884
Alignment:
Q  15 gacatcatctgcttggggttacgaccaccgctgtttgggttacggccaatgctgcggaatccaccaccaatattgcgcgatccaccgtttccagaaattg 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||||  |||||||    
T  21717049 gacatcatctgcttggggttacgaccaccgctgtttgggttacggccactgctgcgggatccaccaccaatattgcacgatccaccgtttctggaaattg 21716950  T
Q  115 aaaatgagtgagatcctctgctattcgaatactctctactgcttgacatcttcgtgcaatgattgg 180  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||    
T  21716949 aaaatgagtgagatcctctgctattcgaataccctctactgcttgacatcttcgcgcaatgattgg 21716884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 27 - 136
Target Start/End: Original strand, 20656645 - 20656754
Alignment:
Q  27 ttggggttacgaccaccgctgtttgggttacggccaatgctgcggaatccaccaccaatattgcgcgatccaccgtttccagaaattgaaaatgagtgag 126  Q
    |||| ||||||||||||  |||||| |||||| |||  | ||||  ||| ||||||| | ||||| ||||||||||||| ||| ||||||||||||||||    
T  20656645 ttggtgttacgaccaccattgtttgcgttacgaccaccgttgcgagatctaccaccactcttgcgggatccaccgtttctagagattgaaaatgagtgag 20656744  T
Q  127 atcctctgct 136  Q
    | ||||||||    
T  20656745 aacctctgct 20656754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0903 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: scaffold0903
Description:

Target: scaffold0903; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 18 - 180
Target Start/End: Complemental strand, 629 - 467
Alignment:
Q  18 atcatctgcttggggttacgaccaccgctgtttgggttacggccaatgctgcggaatccaccaccaatattgcgcgatccaccgtttccagaaattgaaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||| |||  |||         || ||||||||||||||||||||||||||  ||||||||||    
T  629 atcatctgcttggggttacgaccaccgctgtttgggttacgaccaccgctatttgggttacgaccaatattgcgcgatccaccgtttctggaaattgaaa 530  T
Q  118 atgagtgagatcctctgctattcgaatactctctactgcttgacatcttcgtgcaatgattgg 180  Q
    ||||||||||||||||||||||||||||| ||||| ||||||||||| ||| |||||||||||    
T  529 atgagtgagatcctctgctattcgaataccctctattgcttgacatcatcgcgcaatgattgg 467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University