View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17324_low_19 (Length: 209)

Name: NF17324_low_19
Description: NF17324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17324_low_19
NF17324_low_19
[»] chr5 (1 HSPs)
chr5 (6-191)||(19451809-19451994)


Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 6 - 191
Target Start/End: Original strand, 19451809 - 19451994
Alignment:
Q  6 acattcagagcggcttgaatatgtccagctctagcgtaaagatcaacaagacacccaaaatgcaccaaacttggttcaacattgtattccttagtcatca 105  Q
    ||||| |||||  |||| ||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||| || ||||||||||    
T  19451809 acattgagagcctcttggatatgtccagctctagcataaagatcaacaagacatccataatgcaccaaacttggttcaacattgtactctttagtcatca 19451908  T
Q  106 tttcaaaatacatcaacccttcatcaaccattccactatgattacatgcactcaacacaccaacaaaggtgatagaattcggcaca 191  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  19451909 tttcaaaatacattaacccttcatcaaccattccactatgattacatgcactcaacacaccaacaaaagtgatagaattcggcaca 19451994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University