View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17324_low_15 (Length: 242)

Name: NF17324_low_15
Description: NF17324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17324_low_15
NF17324_low_15
[»] chr3 (2 HSPs)
chr3 (118-234)||(43500668-43500784)
chr3 (67-164)||(35131090-35131187)


Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 118 - 234
Target Start/End: Complemental strand, 43500784 - 43500668
Alignment:
Q  118 ttcgttgaatttggatcccatacagttgttgcacggtgcagaagttgtatgatagtcggagcacagaaaaacttacgactcagtcacacaagaactgaag 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  43500784 ttcgttgaatttggatcccatacagttgttgcacggtgcagaagttgtataatagtcggagcacagaaaaacttacgactcagtcacacaagaactgaag 43500685  T
Q  218 aactcgtacagtattat 234  Q
    |||||||||| ||||||    
T  43500684 aactcgtacaatattat 43500668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 67 - 164
Target Start/End: Complemental strand, 35131187 - 35131090
Alignment:
Q  67 gctcctttggagtgacgaataggatcaagcgcatcatctaaccatcttctcttcgttgaatttggatcccatacagttgttgcacggtgcagaagttg 164  Q
    ||||||||||||||||| | ||||||||| |||||||||||||||||||||||||||| ||||||||||| |||||  | ||||| ||||||||||||    
T  35131187 gctcctttggagtgacggagaggatcaagtgcatcatctaaccatcttctcttcgttggatttggatcccctacagccgctgcacagtgcagaagttg 35131090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University