View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17321_high_16 (Length: 228)

Name: NF17321_high_16
Description: NF17321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17321_high_16
NF17321_high_16
[»] chr8 (1 HSPs)
chr8 (49-194)||(10253444-10253589)


Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 49 - 194
Target Start/End: Complemental strand, 10253589 - 10253444
Alignment:
Q  49 atcatctctcagaagaaatgaaaatttgtcctgtggggttttcaacaacaactgccatgcccgataaaattcgggtaacgaataannnnnnnnattaaaa 148  Q
    ||||||||| |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||        |||||||    
T  10253589 atcatctcttagaacaaatgaaaatttgtcctgtggggttttcaacaacaaccgccatgcccgataaaattagggtaacgaataattttttctattaaaa 10253490  T
Q  149 ttttaagggaacctaatgtgtggaaactaaaaattcatattgtgaa 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  10253489 ttttaagggaacctaatgtgtggaaactaaaaattcatattgtgaa 10253444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University