View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1731_low_17 (Length: 410)

Name: NF1731_low_17
Description: NF1731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1731_low_17
NF1731_low_17
[»] chr4 (2 HSPs)
chr4 (227-398)||(50342459-50342630)
chr4 (178-230)||(50342370-50342423)


Alignment Details
Target: chr4 (Bit Score: 156; Significance: 9e-83; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 156; E-Value: 9e-83
Query Start/End: Original strand, 227 - 398
Target Start/End: Original strand, 50342459 - 50342630
Alignment:
Q  227 tttattaatttttctttggttgaataggtgattaggtcactaatttaacttgatatttgtttccaaactgtagttgagaatttattgaggcttgccccgg 326  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||    
T  50342459 tttattaatttttctttggttgaataggtgattaggtcactaatttaacttgatatttgtttccaaactgtagttgagattttgttgaggcttgccctgg 50342558  T
Q  327 ctagactagaattctctgcaacggttacggttaccatccaaattgggtcgtgacaaagttgattgtttataa 398  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50342559 ctagactagaattctctgcaccggttacggttaccatccaaattgggtcgtgacaaagttgattgtttataa 50342630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 178 - 230
Target Start/End: Original strand, 50342370 - 50342423
Alignment:
Q  178 aaccctgagaa-tgaaaaatgaggatctttgaaattatctgttatgtcttttta 230  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  50342370 aaccctgagaaatgaaaaatgaggatctttgaaattatctgttatgtcttttta 50342423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University