View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17318_low_53 (Length: 253)

Name: NF17318_low_53
Description: NF17318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17318_low_53
NF17318_low_53
[»] chr7 (1 HSPs)
chr7 (78-197)||(33527186-33527305)


Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 78 - 197
Target Start/End: Complemental strand, 33527305 - 33527186
Alignment:
Q  78 aatgaaatagtagttgttgactcaaatgaggttatattagtatgaaagtggaaaattatataaggggattgttagttaaaagtttttaactgtattaaag 177  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33527305 aatgaaatagtagttgttgactcaaatgaggttatattagtatgaaagtggaaaattatataaggggattgttagttaaaagtttttaactgtattaaag 33527206  T
Q  178 gataagataatgttttggag 197  Q
    ||||||||||||||||||||    
T  33527205 gataagataatgttttggag 33527186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University