View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17318_low_33 (Length: 333)

Name: NF17318_low_33
Description: NF17318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17318_low_33
NF17318_low_33
[»] chr7 (1 HSPs)
chr7 (1-312)||(45373956-45374267)
[»] chr2 (1 HSPs)
chr2 (253-306)||(37054012-37054065)


Alignment Details
Target: chr7 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 312
Target Start/End: Original strand, 45373956 - 45374267
Alignment:
Q  1 agaggaactcggttatgatgcatggagaggttatggttttgtgtgaagtcgagggtgattgttgggaagggctgagaagctgatagggttgaggttgcga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
T  45373956 agaggaactcggttatgatgcatggagaggttatggttttgtgtgaagtcgagggtgattgttgggaagggctgagaagctgatagggttgaggttgcca 45374055  T
Q  101 ttgttgcatagggaaatgaattagataaatatcctgttgctgattcctttcttagtgttgatgaggttgaacttgatagcagcattgctgcagctgctga 200  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45374056 ttgttgcatagggaaatgaattagataaataacctgttgctgattcctttcttagtgttgatgaggttgaacttgatagcagcattgctgcagctgctga 45374155  T
Q  201 tgttgtgtgtgctatggcagttgcagctggtgggagtgggtgattgtggttgccttcatatgttgttattagtattgtcttgtcttctgcacatctttgg 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45374156 tgttgtgtgtgctatggcagttgcagctggtgggagtgggtgattgtggttgccttcatatgttgttattagtattgtcttgtcttctgcacatctttgg 45374255  T
Q  301 acctgttcaaga 312  Q
    ||||||||||||    
T  45374256 acctgttcaaga 45374267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 253 - 306
Target Start/End: Complemental strand, 37054065 - 37054012
Alignment:
Q  253 ccttcatatgttgttattagtattgtcttgtcttctgcacatctttggacctgt 306  Q
    |||||||||||||| || |||||||| |||||||| ||||| ||||| ||||||    
T  37054065 ccttcatatgttgtgataagtattgttttgtcttcagcacacctttgtacctgt 37054012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University