View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17318_low_24 (Length: 374)

Name: NF17318_low_24
Description: NF17318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17318_low_24
NF17318_low_24
[»] chr7 (2 HSPs)
chr7 (159-336)||(33526806-33526983)
chr7 (49-107)||(33527017-33527075)


Alignment Details
Target: chr7 (Bit Score: 166; Significance: 9e-89; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 166; E-Value: 9e-89
Query Start/End: Original strand, 159 - 336
Target Start/End: Complemental strand, 33526983 - 33526806
Alignment:
Q  159 caatgtttagtgcagttgagttcccgcccccatagattgtttgcaaactagcggttaatgcgaccactgttttgtgatttgcagtcggttagtcaaatac 258  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33526983 caatgtttagtgcagttgagttcccgcccccatagattgtttgcaaactagcggttaatgcgaccactgttttgtgatttgcagtcggttagtcaaatac 33526884  T
Q  259 aaacttaccaaaaataccccactctagtatgaataggatcaagttaatatattatttttctacccttacttaatacaa 336  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||||    
T  33526883 aaacttaccaaaaataccccactctagtatgaataggatcaagttagtatattaattttctacccttgcttaatacaa 33526806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 49 - 107
Target Start/End: Complemental strand, 33527075 - 33527017
Alignment:
Q  49 caatgggcagtttagatggtattgcttcatgttgtgccacttaatagtaaagttagact 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33527075 caatgggcagtttagatggtattgcttcatgttgtgccacttaatagtaaagttagact 33527017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University