View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17318_high_64 (Length: 208)

Name: NF17318_high_64
Description: NF17318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17318_high_64
NF17318_high_64
[»] chr8 (2 HSPs)
chr8 (90-166)||(13337659-13337735)
chr8 (1-46)||(13337572-13337617)


Alignment Details
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 90 - 166
Target Start/End: Original strand, 13337659 - 13337735
Alignment:
Q  90 ctggtgtgagggaactgaactagttgagttcttgtttcagctggaaaataatttataatttataattataatctgaa 166  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  13337659 ctggtgtgagggaactgaactagttgagttcttgtttcagctgaaaaataatttataatttataattataatctgaa 13337735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 13337572 - 13337617
Alignment:
Q  1 tcatcttctgaaatttgtaagttcctttgaatttcagaacaaatat 46  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  13337572 tcatcttctgaaatttgtaagttcctttgaatttcagaacaaatat 13337617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University