View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17318_high_54 (Length: 244)

Name: NF17318_high_54
Description: NF17318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17318_high_54
NF17318_high_54
[»] chr5 (2 HSPs)
chr5 (16-102)||(35688436-35688522)
chr5 (174-231)||(35688307-35688364)


Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 16 - 102
Target Start/End: Complemental strand, 35688522 - 35688436
Alignment:
Q  16 tcatcttctttatacaaaggatgtgtcacgttatctaaaacccatttaccattgaacaagtcacactcttttggtggcaactcaacc 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  35688522 tcatcttctttatacaaaggatgtgtcacgttatctaaaacccatttaccattgaacaagtcacaatcttttggtggcaactcaacc 35688436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 174 - 231
Target Start/End: Complemental strand, 35688364 - 35688307
Alignment:
Q  174 caccttaacacgttcttgtggctcatcagaatcttcatcatcatcaacattcttctca 231  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  35688364 caccttaacacgttcttgtggctcatcagaatcttcatcatcatcaacactcttctca 35688307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University