View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17315_high_31 (Length: 228)

Name: NF17315_high_31
Description: NF17315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17315_high_31
NF17315_high_31
[»] chr1 (1 HSPs)
chr1 (13-209)||(25952156-25952352)
[»] chr7 (1 HSPs)
chr7 (37-146)||(42590775-42590884)


Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 209
Target Start/End: Complemental strand, 25952352 - 25952156
Alignment:
Q  13 agcaaaggggaagatatgggactagcctatttatatagaagtagggattttgtcaaatggacccgagccaaacacccgattcactcggctaaaaccacag 112  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
T  25952352 agcaaaagggaagatatgggactagcctatttatatagaagtagggattttgtcaaatggacccgagccaaacacccgattcactcggctaaaaccactg 25952253  T
Q  113 gtatgtgggagtgtccggatttttacccggtttctttggaagggaaaaacgggttagacgcatcgacgataggtaatagtgttaaacatgtgctaaa 209  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25952252 ggatgtgggagtgtccggatttttacccggtttctttggaagggaaaaacgggttagacgcatcgacgataggtaatagtgttaaacatgtgctaaa 25952156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 37 - 146
Target Start/End: Original strand, 42590775 - 42590884
Alignment:
Q  37 gcctatttatatagaagtagggattttgtcaaatggacccgagccaaacacccgattcactcggctaaaaccacaggtatgtgggagtgtccggattttt 136  Q
    ||||| || ||||| |||||||||||||| ||||||   || |||||||||||||| || ||    |  || || ||||||||||||||||| |||||||    
T  42590775 gcctacttgtataggagtagggattttgtgaaatgggttcgggccaaacacccgatccattcaaaaactactacgggtatgtgggagtgtcctgattttt 42590874  T
Q  137 acccggtttc 146  Q
    ||||||||||    
T  42590875 acccggtttc 42590884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University