View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17309_high_30 (Length: 238)

Name: NF17309_high_30
Description: NF17309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17309_high_30
NF17309_high_30
[»] chr7 (1 HSPs)
chr7 (19-220)||(32728779-32728980)
[»] chr3 (1 HSPs)
chr3 (146-211)||(54181164-54181229)


Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 32728779 - 32728980
Alignment:
Q  19 atgaagcaagaagtgtacaaaattacaatggcacatggtacatacatatatataattagcaaatattatttggctctcacttccagttattggcaacaat 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  32728779 atgaagcaagaagtgtacaaaattacaatggcacatggtacatacatatatataattagcaaatattattcggctctcacttccagttattggcaacaat 32728878  T
Q  119 gtcagccaaatcaacaaccctttgtgagtaaccccattcattatcataccaagcaatcaccttaaccatgtcatctcccataaccattgtcaatgacgaa 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32728879 gtcagccaaatcaacaaccctttgtgagtaaccccattcattatcataccaagcaatcaccttaaccatgtcatctcccataaccattgtcaatgacgaa 32728978  T
Q  219 tc 220  Q
    ||    
T  32728979 tc 32728980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 146 - 211
Target Start/End: Original strand, 54181164 - 54181229
Alignment:
Q  146 gtaaccccattcattatcataccaagcaatcaccttaaccatgtcatctcccataaccattgtcaa 211  Q
    ||||||||||||||| ||||||||||||| |||||| ||||| ||||||||||| ||||| |||||    
T  54181164 gtaaccccattcattgtcataccaagcaaccaccttgaccatatcatctcccatgaccatagtcaa 54181229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University