View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17304_low_24 (Length: 237)

Name: NF17304_low_24
Description: NF17304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17304_low_24
NF17304_low_24
[»] chr8 (2 HSPs)
chr8 (1-109)||(35966889-35966997)
chr8 (98-202)||(35962123-35962243)


Alignment Details
Target: chr8 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 35966997 - 35966889
Alignment:
Q  1 atttcaacttaatcacattatcgctttaatctctttcgtcaattatattatattttaaacattttgacatgtcaaannnnnnngggtatgaaatgtgctc 100  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||    
T  35966997 atttcaacttaatcaaattatcgctttaatctctttcgtcaattatattatattttaaacattttgacatgtcaaatttttttgggtatgaaatgtgctc 35966898  T
Q  101 cttttgtaa 109  Q
    |||||||||    
T  35966897 cttttgtaa 35966889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 98 - 202
Target Start/End: Complemental strand, 35962243 - 35962123
Alignment:
Q  98 ctccttttgtaataccaatgtgtt---aataacaaagttggaattggcttgatatcaaaattacggttaaa-------------ttgattcaacgtagtt 181  Q
    ||||||||||||||||||||||||   |||||||||||||||||||||||||||||||| | |||||||||             |||||||||| |||||    
T  35962243 ctccttttgtaataccaatgtgttgttaataacaaagttggaattggcttgatatcaaagtcacggttaaatacttaaattgatttgattcaacatagtt 35962144  T
Q  182 gaattacacgtctaacaataa 202  Q
    |||||||||||||||||||||    
T  35962143 gaattacacgtctaacaataa 35962123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University