View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17303_low_67 (Length: 203)

Name: NF17303_low_67
Description: NF17303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17303_low_67
NF17303_low_67
[»] chr5 (1 HSPs)
chr5 (28-198)||(38898567-38898737)


Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 28 - 198
Target Start/End: Original strand, 38898567 - 38898737
Alignment:
Q  28 aggtggcattcgatggaagaaattgcagagatatagtacaaatcaaaaagtaatatatataggaacatgttcatatgcattttaaaaagaggaacggatg 127  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||| |||||||||||||||| ||||||| ||||    
T  38898567 aggtggcattcgatggaagaaattgcagagatataggacaaatcaaaatgtaatatatatagtaacatgtgcatatgcattttaaaatgaggaactgatg 38898666  T
Q  128 tcaatgagagattaccgtttagatttggtaacttctcgatagtcaatatactaacattgtgatagtcaagt 198  Q
    | |||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||||||||||    
T  38898667 ttaatgagagattaccgtttcgatttggtaacttcttgatagtcaatatactaacattttgatagtcaagt 38898737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University