View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17303_low_19 (Length: 389)

Name: NF17303_low_19
Description: NF17303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17303_low_19
NF17303_low_19
[»] chr7 (3 HSPs)
chr7 (13-389)||(48085215-48085571)
chr7 (319-364)||(48102491-48102536)
chr7 (325-360)||(1809555-1809590)
[»] chr6 (1 HSPs)
chr6 (322-365)||(7385568-7385611)
[»] chr1 (2 HSPs)
chr1 (312-364)||(35357711-35357763)
chr1 (313-364)||(35376267-35376318)


Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-146; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 13 - 389
Target Start/End: Complemental strand, 48085571 - 48085215
Alignment:
Q  13 cacagaaagaaatgtttgcactaggattgaatcaaaggaagacattttattactgacaatttgagtgggaaaaccagtactcaagaacttggcatgacaa 112  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48085571 cacagaaagaaatgtttgcactaggattgaaacaaaggaagacattttattactgacaatttgagtgggaaaaccagtactcaagaacttggcatgacaa 48085472  T
Q  113 accactagctatggaatacaaaacaaaagattaatggataaattaaagggacacagataaagaaaatacacacataaactaacnnnnnnncattaaccaa 212  Q
    |||||||||||||||||||||||||||||                    ||||||||||||||||||||||||||||||||||       ||||||||||    
T  48085471 accactagctatggaatacaaaacaaaag--------------------gacacagataaagaaaatacacacataaactaacaaaaaaacattaaccaa 48085392  T
Q  213 atgtcttggatggattgatcaagtcctggaatctaaggccatgatagtgctgagattcatgggatacatgtactgagcactgcccctaaggatttggttg 312  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  48085391 atgtcttggatggattgatcaagtcctggaatctaaggccatgatagtgctgagattcatgggatacatgtactgagcactgcccctaaggattcggttg 48085292  T
Q  313 actatgattttgtttgccttttcagatggatggaatgcatcccaaaatgcattaagttgcatggttgggcacaagtt 389  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||   || |||||||||||||    
T  48085291 actatgattttgtttgccttttcagatggatggaatgcatcccaaaaagcattaagttctctgtttgggcacaagtt 48085215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 319 - 364
Target Start/End: Complemental strand, 48102536 - 48102491
Alignment:
Q  319 attttgtttgccttttcagatggatggaatgcatcccaaaatgcat 364  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  48102536 attttgtttgccttttcagatggatggaatgcatcccaaaatgcat 48102491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 325 - 360
Target Start/End: Complemental strand, 1809590 - 1809555
Alignment:
Q  325 tttgccttttcagatggatggaatgcatcccaaaat 360  Q
    ||||||||||||||||||||||||| ||||||||||    
T  1809590 tttgccttttcagatggatggaatggatcccaaaat 1809555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 322 - 365
Target Start/End: Original strand, 7385568 - 7385611
Alignment:
Q  322 ttgtttgccttttcagatggatggaatgcatcccaaaatgcatt 365  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
T  7385568 ttgtttgccttttcagatggatggaatgcatcccaaaatgcatt 7385611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 312 - 364
Target Start/End: Original strand, 35357711 - 35357763
Alignment:
Q  312 gactatgattttgtttgccttttcagatggatggaatgcatcccaaaatgcat 364  Q
    |||||||||| || | || |||||||||||||| |||||||||||||||||||    
T  35357711 gactatgattctgctagctttttcagatggatgaaatgcatcccaaaatgcat 35357763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 313 - 364
Target Start/End: Original strand, 35376267 - 35376318
Alignment:
Q  313 actatgattttgtttgccttttcagatggatggaatgcatcccaaaatgcat 364  Q
    ||||||||| || | || ||||||||||||||||||| ||||||||||||||    
T  35376267 actatgattctgctagctttttcagatggatggaatggatcccaaaatgcat 35376318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University