View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17300_low_7 (Length: 208)

Name: NF17300_low_7
Description: NF17300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17300_low_7
NF17300_low_7
[»] chr5 (1 HSPs)
chr5 (37-208)||(19597275-19597446)
[»] chr3 (1 HSPs)
chr3 (1-56)||(28134203-28134258)
[»] chr8 (1 HSPs)
chr8 (1-56)||(22255974-22256029)


Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 37 - 208
Target Start/End: Original strand, 19597275 - 19597446
Alignment:
Q  37 tggtgttaatggtggtggtggtggctgtgacggaaaagaataacaaggtggtcgtagtggccaatacggtaccatatcataatacagtgttcgaggtggc 136  Q
    ||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  19597275 tggtgttgatggtggtggtggtggctgtgacggaaaagagtaacaaggtggtcgtagtggccaatacggtaccatattataatacagtgttcgaggtggc 19597374  T
Q  137 tgtgatgaagaagatggtaccagcgacagatttgttggtagaatagaatgatatggtggtcgtggtggctgc 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19597375 tgtgatgaagaagatggtaccagcgacagatttgttggtagaatagaatgatatggtggtcgtggtggctgc 19597446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 28134203 - 28134258
Alignment:
Q  1 atcattgggtgatgcttcaacttttgtggattgtcgtggtgttaatggtggtggtg 56  Q
    ||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||    
T  28134203 atcattgggtgatgcttcagcttctgtggattgtcgtggtgctaatggtggtggtg 28134258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 22256029 - 22255974
Alignment:
Q  1 atcattgggtgatgcttcaacttttgtggattgtcgtggtgttaatggtggtggtg 56  Q
    ||||| |||||||||||| |||| |||| |||||||| ||| ||||||||||||||    
T  22256029 atcatagggtgatgcttctacttctgtgaattgtcgtagtgctaatggtggtggtg 22255974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University