View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1729_low_25 (Length: 298)

Name: NF1729_low_25
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1729_low_25
NF1729_low_25
[»] chr1 (2 HSPs)
chr1 (157-284)||(8393103-8393231)
chr1 (12-96)||(8393286-8393370)


Alignment Details
Target: chr1 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 157 - 284
Target Start/End: Complemental strand, 8393231 - 8393103
Alignment:
Q  157 agatatgaacctcatacctttgactatatattatgcattgtacatatcagttaaattaaactcacaaaaaca-cccattttatttttcatacagatattc 255  Q
    |||| |||| ||||||||||| |||||||||||||||||||||||| ||| ||||||||||||||| | ||| ||| |||||||||||||||  ||||||    
T  8393231 agatttgaatctcatacctttaactatatattatgcattgtacataccagctaaattaaactcacatagacacccccttttatttttcataccaatattc 8393132  T
Q  256 aacatctcattttccttttaccactcttt 284  Q
    |||||||||||||||||||||||||||||    
T  8393131 aacatctcattttccttttaccactcttt 8393103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 12 - 96
Target Start/End: Complemental strand, 8393370 - 8393286
Alignment:
Q  12 agagatggggtggtatggtatggtatgggatatgggcatcattgggtttgttatttcctcttgttttctagtaatttcggtgttc 96  Q
    ||||| || ||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||||| |||||||    
T  8393370 agagagggtgtggtatggtatggtatgggaaatgggaatcattgggtttgttattttctcttgttttctagtaattttggtgttc 8393286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University