View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17298_low_7 (Length: 226)

Name: NF17298_low_7
Description: NF17298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17298_low_7
NF17298_low_7
[»] scaffold0194 (1 HSPs)
scaffold0194 (55-226)||(26283-26454)


Alignment Details
Target: scaffold0194 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: scaffold0194
Description:

Target: scaffold0194; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 55 - 226
Target Start/End: Complemental strand, 26454 - 26283
Alignment:
Q  55 tattacaacttctttcctagtttgtgtctaactctaaccattgtttaaaactttggtgcaatatagtgagctagaacatacaatttttcttgaagaaaat 154  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26454 tattacaacttctttcctagtttgtgtctaactctaaccattgtttaaaactttggtgcaatatagtgagctagaacatacaatttttcttgaagaaaat 26355  T
Q  155 aaataaattaaaattaccctttgcacgtatgaaccaggcatgagggatctaagaacacgaagatgttcattc 226  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26354 aaataaattaaaattaccctttgcacgtatgaaccaggcatgagggatctaagaacacgaagatgttcattc 26283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University