View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17290_high_13 (Length: 230)

Name: NF17290_high_13
Description: NF17290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17290_high_13
NF17290_high_13
[»] chr8 (2 HSPs)
chr8 (18-108)||(10214232-10214322)
chr8 (172-215)||(10214125-10214168)


Alignment Details
Target: chr8 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 18 - 108
Target Start/End: Complemental strand, 10214322 - 10214232
Alignment:
Q  18 tctcttacatttcagaataattcgttgctgtattcgacctgaataccttcaatttctaccgcattcgctccaccacctttcttggttagtt 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10214322 tctcttacatttcagaataattcgttgctgtattcgacctgaataccttcaatttctaccgcattcgctccaccacctttcttggttagtt 10214232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 172 - 215
Target Start/End: Complemental strand, 10214168 - 10214125
Alignment:
Q  172 ttaaattagcgattaaggttgatggatgcttttgttaatttcat 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
T  10214168 ttaaattagcgattaaggttgatggatgcttttgttaatttcat 10214125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University