View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17290_high_11 (Length: 246)

Name: NF17290_high_11
Description: NF17290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17290_high_11
NF17290_high_11
[»] chr1 (1 HSPs)
chr1 (151-238)||(40944283-40944370)


Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 151 - 238
Target Start/End: Complemental strand, 40944370 - 40944283
Alignment:
Q  151 tacaagtaaattttcataaaaatcatctttacaaatataaaacatgatctaaaaatttattatcttcataacacagcacagtattatc 238  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||    
T  40944370 tacaagtaaattttcataaaaatcatctttacaaatataaaacatgatctaaaaatttattatcttcataacacaccacactattatc 40944283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University