View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1728_high_2 (Length: 388)

Name: NF1728_high_2
Description: NF1728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1728_high_2
NF1728_high_2
[»] chr4 (1 HSPs)
chr4 (245-388)||(35112468-35112611)
[»] chr7 (1 HSPs)
chr7 (270-386)||(47987982-47988098)


Alignment Details
Target: chr4 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 245 - 388
Target Start/End: Complemental strand, 35112611 - 35112468
Alignment:
Q  245 gcgcaaaacaaaataagccaacggattccagacgtgtttggaagggaatgaattatcacctcatccgttgccgaaaacgactctgataccaaacattgcc 344  Q
    ||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||    
T  35112611 gcgcaaaacaaaataagccaactaattccagacgtgtttggaagggaatgaattatcacctcatccgttgccgaaaacgacaccgataccaaacattgcc 35112512  T
Q  345 gtgtcaaattgatccatagcccaaaaatatcagtccacgtgtga 388  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
T  35112511 gtgtcaaattgatccatagcccaaaaatatcagtccacgtgtga 35112468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 93; Significance: 3e-45; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 270 - 386
Target Start/End: Original strand, 47987982 - 47988098
Alignment:
Q  270 ttccagacgtgtttggaagggaatgaattatcacctcatccgttgccgaaaacgactctgataccaaacattgccgtgtcaaattgatccatagcccaaa 369  Q
    ||||||||||||||||||||||||| ||| |||||||||| ||||| | ||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  47987982 ttccagacgtgtttggaagggaatgcattgtcacctcatctgttgctgtaaacgactcagataccaaacattgccgtgtcaaattgatccatagcccaaa 47988081  T
Q  370 aatatcagtccacgtgt 386  Q
    |||||||||||||||||    
T  47988082 aatatcagtccacgtgt 47988098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University