View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17288_low_86 (Length: 204)

Name: NF17288_low_86
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17288_low_86
NF17288_low_86
[»] chr1 (2 HSPs)
chr1 (21-190)||(10481205-10481374)
chr1 (141-190)||(10545599-10545648)


Alignment Details
Target: chr1 (Bit Score: 114; Significance: 5e-58; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 21 - 190
Target Start/End: Original strand, 10481205 - 10481374
Alignment:
Q  21 ataatataccacatggtatgacttgctatatacaccccctacaaaataagtggctcttaaattagcaatcccctttcttactttattgttctcatttgat 120  Q
    ||||||||||||| ||| | |||||||||||||||||| |  ||||||| |||  | |||||||| |||||||||||||| ||||||  |||||||||||    
T  10481205 ataatataccacaaggtgtaacttgctatatacacccctttaaaaataaatggggcgtaaattagtaatcccctttcttaatttattaatctcatttgat 10481304  T
Q  121 gaacttggtgattcaggacatatacaatttgggtggtagatcattttggatacacaacacaggacccatt 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10481305 gaacttggtgattcaggacatatacaatttgggtggtagatcattttggatacacaacacaggacccatt 10481374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 10545648 - 10545599
Alignment:
Q  141 tatacaatttgggtggtagatcattttggatacacaacacaggacccatt 190  Q
    ||||||||||||| | ||||||||||||||||||||||||||||||||||    
T  10545648 tatacaatttgggggctagatcattttggatacacaacacaggacccatt 10545599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University