View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17288_low_77 (Length: 210)

Name: NF17288_low_77
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17288_low_77
NF17288_low_77
[»] chr4 (3 HSPs)
chr4 (1-201)||(32184460-32184660)
chr4 (30-125)||(32177369-32177464)
chr4 (162-201)||(32177284-32177323)


Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 32184660 - 32184460
Alignment:
Q  1 gatatcttccttctttcacctctcatttcaatcactcaacaactttctctacctaactataccttgtttacttcttcagcttctatgttctccttctttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  32184660 gatatcttccttctttcacctctcatttcaatcactcaacaactttctctacctaactataccttgtttacttcttcagcttccatgttctccttctttt 32184561  T
Q  101 ctcacttccctactcttgctcaatcaatatctgatgcttctgctgagatttctgagataccagttccaggtattgcattttcacctttaccatattcatc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32184560 ctcacttccctactcttgctcaatcaatatctgatgcttctgctgagatttctgagataccagttccaggtattgcattttcacctttaccatattcatc 32184461  T
Q  201 t 201  Q
    |    
T  32184460 t 32184460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 30 - 125
Target Start/End: Complemental strand, 32177464 - 32177369
Alignment:
Q  30 aatcactcaacaactttctctacctaactataccttgtttacttcttcagcttctatgttctccttcttttctcacttccctactcttgctcaatc 125  Q
    |||||||||| |||||||||| ||||| || | ||||   ||||||||  || ||||||||||||| || ||||| ||||||||||||||||||||    
T  32177464 aatcactcaaaaactttctctccctaattacatcttgaacacttcttcttctgctatgttctccttattctctcatttccctactcttgctcaatc 32177369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 32177323 - 32177284
Alignment:
Q  162 agttccaggtattgcattttcacctttaccatattcatct 201  Q
    ||||||||| ||| ||||||||||||||||||||||||||    
T  32177323 agttccaggcattccattttcacctttaccatattcatct 32177284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University