View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17288_low_26 (Length: 421)

Name: NF17288_low_26
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17288_low_26
NF17288_low_26
[»] chr5 (1 HSPs)
chr5 (1-71)||(15260378-15260451)


Alignment Details
Target: chr5 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 15260451 - 15260378
Alignment:
Q  1 ggtaatgaaggatacacgtatgaactatatagaaaagaaagaa---aaaatcaataatggtgtagggttattag 71  Q
    |||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||| |||||    
T  15260451 ggtaatgaaggatacacgtatgaactatatagaaaagaaagaaaaaaaaatcaataatggtgtagggtcattag 15260378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University