View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17287_low_86 (Length: 211)

Name: NF17287_low_86
Description: NF17287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17287_low_86
NF17287_low_86
[»] chr6 (1 HSPs)
chr6 (1-113)||(24809145-24809257)


Alignment Details
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 24809257 - 24809145
Alignment:
Q  1 atgtatgtgtttcagagtttatattatgttttcatgtatacatataattacatgttcatttactcatgtaagggttttatacttgtattgtataatgtat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24809257 atgtatgtgtttcagagtttatattatgttttcatgtatacatataattacatgttcatttactcatgtaagggttttatacttgtattgtataatgtat 24809158  T
Q  101 agtatagtataat 113  Q
    |||||||||||||    
T  24809157 agtatagtataat 24809145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University