View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17287_low_53 (Length: 292)

Name: NF17287_low_53
Description: NF17287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17287_low_53
NF17287_low_53
[»] chr4 (2 HSPs)
chr4 (12-184)||(30781952-30782124)
chr4 (215-276)||(30782240-30782301)


Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 12 - 184
Target Start/End: Original strand, 30781952 - 30782124
Alignment:
Q  12 tgaagacttggaattaggtctttgctgatgataggaatgattcaaagcaaagtaaaccgtcccttttcttgcaaccattggtacaataagcgatgttcaa 111  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||    
T  30781952 tgaagactaggaattaggtctttgctgatgataggaatgattcaaagcaaagtaaacggtcccttctcttgcaaccattggtacaataagcgatgttcaa 30782051  T
Q  112 agagagaactttctttgttgttgcttgatcttcttactaggttatgcttcttcatagttctatcttgttattg 184  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  30782052 agagagaattttctttgttgttgcttgatcttcttactaggttatgcttcttcattgttctatcttgttattg 30782124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 215 - 276
Target Start/End: Original strand, 30782240 - 30782301
Alignment:
Q  215 gtcgggtctcctttcatgggcctttgtaacacggaattgttgcaactgactccgttcaagaa 276  Q
    ||||||||||||||||||||  |||||||||||||||||||||||| |||||||||||||||    
T  30782240 gtcgggtctcctttcatgggaatttgtaacacggaattgttgcaaccgactccgttcaagaa 30782301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University