View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17285_low_31 (Length: 207)

Name: NF17285_low_31
Description: NF17285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17285_low_31
NF17285_low_31
[»] chr2 (1 HSPs)
chr2 (15-95)||(14937344-14937424)


Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 15 - 95
Target Start/End: Original strand, 14937344 - 14937424
Alignment:
Q  15 cagagaaaaacgaacgacctaagaggttggtggtttgcgggactgtggaaaatgttaacgatcttatgcggcggaatcagt 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14937344 cagagaaaaacgaacgacctaagaggttggtggtttgcgggactgtggaaaatgttaacgatcttatgcggcggaatcagt 14937424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University