View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17277_low_170 (Length: 224)

Name: NF17277_low_170
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17277_low_170
NF17277_low_170
[»] chr5 (1 HSPs)
chr5 (36-214)||(24456668-24456848)


Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 36 - 214
Target Start/End: Original strand, 24456668 - 24456848
Alignment:
Q  36 ctaacccttcatcttccgaacttcttcgccaatttcaagtagctcttaaacgccgtcgaaatcccggtaccgttcttcttctcataa--ttttttatgtt 133  Q
    |||||||||| ||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||  |||||||||||    
T  24456668 ctaacccttcctcttccgaactcctccgccaatttcaagtagctcttaaacgccgtcgaaaccccggtaccgttcctcttctcataactttttttatgtt 24456767  T
Q  134 tctacttcttcattcagtttctgttgttaatttttgtgaattctttatcaggtggtgcgttgcaatcgaatattcttcgac 214  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  24456768 tctacttcttcattcagtttctgatgttaatttttgtgaattctttatcaggtggtgcgttgcaatcgaatattattcgac 24456848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University