View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17277_high_115 (Length: 264)

Name: NF17277_high_115
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17277_high_115
NF17277_high_115
[»] chr3 (2 HSPs)
chr3 (179-264)||(29594056-29594141)
chr3 (40-93)||(29597232-29597285)


Alignment Details
Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 179 - 264
Target Start/End: Complemental strand, 29594141 - 29594056
Alignment:
Q  179 accatcaattcaacttcaactaaagcaaattaaccccttaaaccacaaattagtgtataataataaatcattactttcgacaataa 264  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29594141 accatcaattcgacttcaactaaagcaaattaaccccttaaaccacaaattagtgtataataataaatcattactttcgacaataa 29594056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 40 - 93
Target Start/End: Complemental strand, 29597285 - 29597232
Alignment:
Q  40 tgtattgaagcctaacgtaacaaaaccgttagttgtcgtgggtacaagattgaa 93  Q
    ||||||||||||||||| ||||||||||||||||| | || |||||||||||||    
T  29597285 tgtattgaagcctaacgcaacaaaaccgttagttgccttgtgtacaagattgaa 29597232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University