View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17277_high_106 (Length: 281)

Name: NF17277_high_106
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17277_high_106
NF17277_high_106
[»] chr1 (2 HSPs)
chr1 (36-152)||(3258780-3258896)
chr1 (169-266)||(3258882-3258979)


Alignment Details
Target: chr1 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 36 - 152
Target Start/End: Original strand, 3258780 - 3258896
Alignment:
Q  36 gtctcatattcgagtctttatatgaaaaaatgtggttggtaggaaaaacccacttaaagttcttgtcaaacttttcgatagagattactaatcggtgaag 135  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||    
T  3258780 gtctcatattcgagtctttatatgaaaaaatgtggttggtaggaaaaacccacttaaagttcttgtcaaatttttcgatagagattactaattggtgaag 3258879  T
Q  136 tagtagacacttcgcat 152  Q
    |||||||||||||||||    
T  3258880 tagtagacacttcgcat 3258896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 169 - 266
Target Start/End: Original strand, 3258882 - 3258979
Alignment:
Q  169 gtagacacttcgcatcaagatcatcttaagaatacacttgtttggtgtagacaaaaatattgtttgctaatagaattttgaattattaccttcttttt 266  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3258882 gtagacacttcgcatcaagatcatcttaagaatacacttgtttggtgtagacaaaaatattgtttgctaatagaattttgaattattaccttcttttt 3258979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University