View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17275_low_41 (Length: 228)

Name: NF17275_low_41
Description: NF17275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17275_low_41
NF17275_low_41
[»] chr2 (1 HSPs)
chr2 (23-141)||(12250630-12250747)
[»] chr4 (1 HSPs)
chr4 (60-136)||(11120636-11120715)


Alignment Details
Target: chr2 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 23 - 141
Target Start/End: Complemental strand, 12250747 - 12250630
Alignment:
Q  23 ttagctataaatatttaccttgctttcgttagcatttcatttcatccacacttgcttttctattggttttctttccgttaaaccatttacactttccaca 122  Q
    ||||||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
T  12250747 ttagctataaatatttaccttgcattccttagcatt-catttcatccacacttgcttttctattggttttctttcagttaaaccatttacactttccaca 12250649  T
Q  123 aaatcattcatggcgtggg 141  Q
    |||||||||||||||||||    
T  12250648 aaatcattcatggcgtggg 12250630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 60 - 136
Target Start/End: Complemental strand, 11120715 - 11120636
Alignment:
Q  60 catttcatccacacttgcttttctattggttttctt---tccgttaaaccatttacactttccacaaaatcattcatggc 136  Q
    ||||||||||||||||  |||||||| | |||||||   ||  ||||||||| |||| |||| |||||||||||||||||    
T  11120715 catttcatccacacttatttttctatagcttttcttctttcatttaaaccatatacagtttctacaaaatcattcatggc 11120636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University